circad | circRNAs associated with diseases

Circ-SERPINE2
Gene	SERPINE2	Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	31199037
Experimental Method
Sample Type	Tissues	Comparison	Tissues and adjacent tissues of GC samples were obtained from 49 GC patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCCGAGAACACAAAGAAACGC Reverse AAGAGGGGGAGATGCCAGTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, J, Song, S, Lin, S, Zhang, M, Du, Y, Zhang, D, Xu, W, Wang, H (2019). Circ-SERPINE2 promotes the development of gastric carcinoma by sponging miR-375 and modulating YWHAZ. Cell Prolif., 52, 4:e12648.